PMID- 21565928
OWN - NLM
STAT- MEDLINE
DCOM- 20120111
LR  - 20200826
IS  - 1465-2080 (Electronic)
IS  - 1350-0872 (Linking)
VI  - 157
IP  - Pt 9
DP  - 2011 Sep
TI  - Characterization of the KstR-dependent promoter of the gene for the first step of 
      the cholesterol degradative pathway in Mycobacterium smegmatis.
PG  - 2670-2680
LID - 10.1099/mic.0.049213-0 [doi]
AB  - The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, 
      which encodes the 3-beta-hydroxysteroid dehydrogenase (3-beta HSD(MS)) responsible for 
      the first step in the cholesterol degradative pathway, has been characterized. 
      Primer extension analysis of the P(5)(2)(2)(8) promoter showed that the transcription 
      starts at the ATG codon, thus generating a leaderless mRNA lacking a 5' 
      untranslated region (5'UTR). Footprint analyses demonstrated experimentally that 
      KstR specifically binds to an operator region of 31 nt containing the 
      quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the -5 and -35 
      positions with respect to the transcription start site. This region overlaps with 
      the -10 and -35 boxes of the P(5)(2)(2)(8) promoter, suggesting that KstR represses 
      MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a 
      P(5)(2)(2)(8)-beta-galactosidase fusion we have demonstrated that KstR is able to work as a 
      repressor in a heterologous system like Escherichia coli. A 3D model of the KstR 
      protein revealed folding typical of TetR-type regulators, with two domains, i.e. 
      a DNA-binding N-terminal domain and a regulator-binding C-terminal domain 
      composed of six helices with a long tunnel-shaped hydrophobic pocket that might 
      interact with a putative highly hydrophobic inducer. The finding that similar 
      P(5)(2)(2)(8) promoter regions have been found in all mycobacterial strains examined, 
      with the sole exception of Mycobacterium tuberculosis, provides new clues about 
      the role of cholesterol in the pathogenicity of this micro-organism.
FAU - Uhia, Iria
AU  - Uhia I
AD  - Department of Environmental Biology, Centro de Investigaciones Biologicas, 
      Consejo Superior de Investigaciones Cientificas, Madrid, Spain.
FAU - Galan, Beatriz
AU  - Galan B
AD  - Department of Environmental Biology, Centro de Investigaciones Biologicas, 
      Consejo Superior de Investigaciones Cientificas, Madrid, Spain.
FAU - Medrano, Francisco Javier
AU  - Medrano FJ
AD  - Department of Chemical and Physical Biology, Centro de Investigaciones 
      Biologicas, Consejo Superior de Investigaciones Cientificas, Madrid, Spain.
FAU - Garcia, Jose Luis
AU  - Garcia JL
AD  - Department of Environmental Biology, Centro de Investigaciones Biologicas, 
      Consejo Superior de Investigaciones Cientificas, Madrid, Spain.
LA  - eng
PT  - Journal Article
PT  - Research Support, Non-U.S. Gov't
DEP - 20110512
PL  - England
TA  - Microbiology (Reading)
JT  - Microbiology (Reading, England)
JID - 9430468
RN  - 0 (Repressor Proteins)
RN  - 97C5T2UQ7J (Cholesterol)
RN  - EC 1.1.- (3-Hydroxysteroid Dehydrogenases)
SB  - IM
MH  - 3-Hydroxysteroid Dehydrogenases/*genetics/metabolism
MH  - Base Sequence
MH  - Cholesterol/*metabolism
MH  - Gene Expression Regulation, Bacterial
MH  - Metabolic Networks and Pathways/genetics
MH  - Models, Molecular
MH  - Molecular Sequence Data
MH  - Mycobacterium smegmatis/*genetics/*metabolism
MH  - *Promoter Regions, Genetic
MH  - Protein Conformation
MH  - Repressor Proteins/chemistry/*metabolism
MH  - Sequence Alignment
MH  - Transcription Initiation Site
EDAT- 2011/05/14 06:00
MHDA- 2012/01/12 06:00
CRDT- 2011/05/14 06:00
PHST- 2011/05/14 06:00 [entrez]
PHST- 2011/05/14 06:00 [pubmed]
PHST- 2012/01/12 06:00 [medline]
AID - 10.1099/mic.0.049213-0 [doi]
PST - ppublish
SO  - Microbiology (Reading). 2011 Sep;157(Pt 9):2670-2680. doi: 
      10.1099/mic.0.049213-0. Epub 2011 May 12.