PMID- 22026581
OWN - NLM
STAT- MEDLINE
DCOM- 20120823
LR  - 20120410
IS  - 1365-2265 (Electronic)
IS  - 0300-0664 (Linking)
VI  - 76
IP  - 5
DP  - 2012 May
TI  - Novel mutations in MEN1, CDKN1B and AIP genes in patients with multiple endocrine 
      neoplasia type 1 syndrome in Spain.
PG  - 719-24
LID - 10.1111/j.1365-2265.2011.04269.x [doi]
AB  - CONTEXT: Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant 
      disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with 
      MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP 
      have been showed to be involved in MEN1-like patients. OBJECTIVE: The aim of this 
      study was to perform a genetic screening in our cohort or patients with suspected 
      MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage 
      analysis of MEN1 and AIP. RESULTS: A total of 79 different sporadic and familial 
      cases with the MEN1 phenotype have been studied, in which 34 of them (48%) 
      present a mutation in MEN1 gene. In two patients without a detectable mutation in 
      MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in 
      CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. 
      His275GlnfsX49) in AIP gene, respectively. CONCLUSIONS: Our data support that 
      MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We 
      confirm that in those patients without MEN1 gene mutation, other genes such as 
      CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.
CI  - (c) 2012 Blackwell Publishing Ltd.
FAU - Belar, Oihana
AU  - Belar O
AD  - Endocrinology Research group, Cruces' Hospital, CIBERER, Barakaldo, Bizkaia, 
      Spain.
FAU - De La Hoz, Carmen
AU  - De La Hoz C
FAU - Perez-Nanclares, Gustavo
AU  - Perez-Nanclares G
FAU - Castano, Luis
AU  - Castano L
FAU - Gaztambide, Sonia
AU  - Gaztambide S
CN  - Spanish MEN1 Group
LA  - eng
PT  - Journal Article
PT  - Research Support, Non-U.S. Gov't
PL  - England
TA  - Clin Endocrinol (Oxf)
JT  - Clinical endocrinology
JID - 0346653
RN  - 0 (CDKN1B protein, human)
RN  - 0 (Intracellular Signaling Peptides and Proteins)
RN  - 0 (MEN1 protein, human)
RN  - 0 (Proto-Oncogene Proteins)
RN  - 0 (aryl hydrocarbon receptor-interacting protein)
RN  - 147604-94-2 (Cyclin-Dependent Kinase Inhibitor p27)
SB  - IM
MH  - Amino Acid Sequence
MH  - Base Sequence
MH  - Cohort Studies
MH  - Cyclin-Dependent Kinase Inhibitor p27/*genetics
MH  - DNA Mutational Analysis
MH  - Frameshift Mutation
MH  - Genetic Testing
MH  - Humans
MH  - Intracellular Signaling Peptides and Proteins/*genetics
MH  - Multiple Endocrine Neoplasia Type 1/diagnosis/*genetics
MH  - *Mutation
MH  - Mutation, Missense
MH  - Proto-Oncogene Proteins/*genetics
MH  - Spain
MH  - Syndrome
FIR - Moreno, A
IR  - Moreno A
FIR - Valdes, N
IR  - Valdes N
FIR - Aller, J
IR  - Aller J
FIR - Rubio, M
IR  - Rubio M
FIR - Quintana, B
IR  - Quintana B
FIR - Vazquez, F
IR  - Vazquez F
FIR - Lamas, C
IR  - Lamas C
FIR - Morilla, C
IR  - Morilla C
FIR - Alvarez Coca, M
IR  - Alvarez Coca M
FIR - Yoldi, A
IR  - Yoldi A
FIR - Icobalceta, A
IR  - Icobalceta A
FIR - Beitia, J J
IR  - Beitia JJ
FIR - Guillen, C
IR  - Guillen C
FIR - Castillo, L
IR  - Castillo L
FIR - Ruiz, E
IR  - Ruiz E
FIR - Orellana, C
IR  - Orellana C
FIR - Campos, V
IR  - Campos V
FIR - Merino, J F
IR  - Merino JF
FIR - Gomez, M
IR  - Gomez M
FIR - Segura, A
IR  - Segura A
FIR - Serrano, J
IR  - Serrano J
FIR - Ojeda, A
IR  - Ojeda A
FIR - Boronat, M
IR  - Boronat M
FIR - Acha, J
IR  - Acha J
FIR - Forga, L
IR  - Forga L
FIR - Lucas, T
IR  - Lucas T
FIR - Benito, P
IR  - Benito P
FIR - Galvez, M A
IR  - Galvez MA
FIR - Castano, G
IR  - Castano G
FIR - Perez de Nanclares, G
IR  - Perez de Nanclares G
FIR - Anton, M
IR  - Anton M
FIR - Fernandez, I
IR  - Fernandez I
FIR - Diaz de Grenu, C
IR  - Diaz de Grenu C
FIR - Cespedes, S
IR  - Cespedes S
FIR - Lopez de la Torre, M
IR  - Lopez de la Torre M
FIR - Castillo, L
IR  - Castillo L
FIR - Navarro, E
IR  - Navarro E
FIR - Soto, A
IR  - Soto A
EDAT- 2011/10/27 06:00
MHDA- 2012/08/24 06:00
CRDT- 2011/10/27 06:00
PHST- 2011/10/27 06:00 [entrez]
PHST- 2011/10/27 06:00 [pubmed]
PHST- 2012/08/24 06:00 [medline]
AID - 10.1111/j.1365-2265.2011.04269.x [doi]
PST - ppublish
SO  - Clin Endocrinol (Oxf). 2012 May;76(5):719-24. doi: 
      10.1111/j.1365-2265.2011.04269.x.