PMID- 8954786
OWN - NLM
STAT- MEDLINE
DCOM- 19970317
LR  - 20091119
IS  - 0888-7543 (Print)
IS  - 0888-7543 (Linking)
VI  - 38
IP  - 1
DP  - 1996 Nov 15
TI  - Structure and chromosomal assignment of the human cyclin G gene.
PG  - 92-5
AB  - Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino 
      acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 
      amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G 
      (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and 
      in the first intron, one distinct putative binding site for the p53 tumor 
      suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed 
      chromosome mapping utilizing the fluorescence in situ hybridization (FISH) 
      technique using both cDNA and genomic DNA for cyclin G. FISH localizes human 
      cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of 
      human cyclin G, four cases of chromosomal translocations in human hematopoietic 
      tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, 
      non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important 
      to examine whether chromosomal translocations around this region cause aberrant 
      cyclin G expression in a manner that is causally related to leukemia.
FAU - Endo, Y
AU  - Endo Y
AD  - Department of Biochemistry, Fukushima Medical College, Japan.
FAU - Fujita, T
AU  - Fujita T
FAU - Tamura, K
AU  - Tamura K
FAU - Tsuruga, H
AU  - Tsuruga H
FAU - Nojima, H
AU  - Nojima H
LA  - eng
SI  - GENBANK/D78341
SI  - GENBANK/D86077
SI  - GENBANK/X70871
PT  - Journal Article
PT  - Research Support, Non-U.S. Gov't
PL  - United States
TA  - Genomics
JT  - Genomics
JID - 8800135
RN  - 0 (CCNG1 protein, human)
RN  - 0 (Ccng1 protein, mouse)
RN  - 0 (Ccng1 protein, rat)
RN  - 0 (Cyclin G)
RN  - 0 (Cyclin G1)
RN  - 0 (Cyclins)
RN  - 9007-49-2 (DNA)
SB  - IM
MH  - Amino Acid Sequence
MH  - Animals
MH  - Base Sequence
MH  - Chromosome Mapping
MH  - *Chromosomes, Human, Pair 5
MH  - Cyclin G
MH  - Cyclin G1
MH  - Cyclins/*genetics
MH  - DNA
MH  - Humans
MH  - In Situ Hybridization, Fluorescence
MH  - Molecular Sequence Data
EDAT- 1996/11/15 00:00
MHDA- 1996/11/15 00:01
CRDT- 1996/11/15 00:00
PHST- 1996/11/15 00:00 [pubmed]
PHST- 1996/11/15 00:01 [medline]
PHST- 1996/11/15 00:00 [entrez]
AID - S0888-7543(96)90598-4 [pii]
AID - 10.1006/geno.1996.0598 [doi]
PST - ppublish
SO  - Genomics. 1996 Nov 15;38(1):92-5. doi: 10.1006/geno.1996.0598.